Y-SNP Data Record for M269

Name   M269
Synonym   None
NCBI RefSNPID   rs9786153
Location: band   q11.222
Location: gene   EIF1AY
Ref Sequence base   21077492
Mutation   C->T
Primers: fwd   ctaaagatcagagtatctccctttg
Primers: rev   aaattgttttcaatttaccag
Length   379
Position   358
Haplogroup   R1b1c
Equivalent SNPs   none

About this SNP:
M269 marks the most common haplogroup found in Europe. Its frequency exceeds 80% in parts of western Europe and it occurs at lower frequencies in central and eastern Europe. It marks an ancient migration into Europe prior to the LGM and is believed to have survived in refugia in Iberia, the Balkans and possibly elsewhere before expanding northwards again. It apparently comprises two major branches defined by DYS1/p49a,f haplotypes 15 and 35 but this branching cannot yet be included in the tree because the underlying mutation is not verified as a unique event polymorphism.

Relevant Papers
Cruciani et al. 2002   http://www.journals.uchicago.edu/AJHG/journal/issues/v70n5/013596/013596.html
Cinnioglu et al 2004   http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf

(Most useful links to be agreed by the group)